#include "bits/stdc++.h"
using namespace std;
const int MAXN = 2e5 + 10;
const int MOD = 120717661;
#define int long long
#define ll __int128
mt19937_64 rng((int)std::chrono::steady_clock::now().time_since_epoch().count());
int rnd(int x, int y) {
int u = uniform_int_distribution<int>(x, y)(rng); return u;
}
ll read() { // read int128
int x; cin >> x; return (ll)x;
}
long long bm(long long b, long long p) {
if(p==0) return 1 % MOD;
long long r = bm(b, p >> 1);
if(p&1) return (((r*r) % MOD) * b) % MOD;
return (r*r) % MOD;
}
long long inv(long long b) {
return bm(b, MOD-2);
}
long long f[MAXN];
long long nCr(int n, int r) {
long long ans = f[n]; ans *= inv(f[r]); ans %= MOD;
ans *= inv(f[n-r]); ans %= MOD; return ans;
}
void precomp() {
for(int i=0; i<MAXN; i++) f[i] = (i == 0 ? 1 % MOD : (f[i-1] * i) % MOD);
}
void solve(int tc) {
int n, m;
cin >> n >> m;
string s[n];
for(int i=0; i<n; i++) {
cin >> s[i];
}
sort(s, s+n);
const int wow = 137;
vector<int> hash[n];
for(int i=0; i<n; i++) {
hash[i].resize(s[i].size());
hash[i][0] = s[i][0] - 'A' + 1;
for(int j=1; j<s[i].size(); j++) {
hash[i][j] = (hash[i][j-1] * wow + s[i][j] - 'A' + 1) % MOD;
}
}
#ifdef ONLINE_JUDGE
const int maxQ = 2010000;
#endif
#ifndef ONLINE_JUDGE
const int maxQ = 20000;
#endif
int pows[maxQ];
pows[0] = 1;
for(int i=1; i<maxQ; i++) pows[i] = (pows[i-1] * wow) % MOD;
while(m--) {
string p, q;
cin >> p >> q;
int P = p.size(), Q = q.size();
int lb = 0, rb = n - 1;
int L, R;
while(lb < rb) {
int mid = (lb + rb) >> 1;
if(s[mid].substr(0, P) >= p) rb = mid;
else lb = mid + 1;
}
int lb2 = 0, rb2 = n - 1;
while(lb2 < rb2) {
int mid = (lb2 + rb2 + 1) >> 1;
if(s[mid].substr(0, P) <= p) lb2 = mid;
else rb2 = mid - 1;
}
if(s[lb].substr(0, P) == p) {
L = lb, R = lb2;
}
else {
cout << "0\n"; continue;
}
///if(Q > 2000) {
int rhs = 0;
for(int i=0; i<Q; i++) rhs = (rhs * wow + q[i] - 'A' + 1) % MOD;
int ans = 0;
for(int i=L; i<=R; i++) {
if(s[i].size() < Q) continue;
int lhs = (hash[i][hash[i].size() - 1] - (Q == hash[i].size() ? 0 : hash[i][hash[i].size() - Q - 1] * pows[Q]) + MOD * pows[Q]) % MOD;
ans += (lhs == rhs);
//cout << s[i].substr(s[i].size() - Q, Q) << " " << lhs << " vs " << q << " " << rhs << "\n";
}
cout << ans << "\n"; continue;
//}
//else {
//}
}
}
int32_t main(){
ios::sync_with_stdio(0); cin.tie(0);
int t = 1; //cin >> t;
for(int i=1; i<=t; i++) solve(i);
}
/*
8 7
GCGCUACCCCAACACAAGGCAAGAUAUA
G
GGAC
GCGG
U
GCGCUACCCCAACACAAGGCAAGAUGGUC
GCCG
GCGCUGA
GCGCUACCC A
GCGCUACCCC AC
GCG C
GCGC A
G G
G C
G GGA
*/
Compilation message
selling_rna.cpp: In function 'void solve(long long int)':
selling_rna.cpp:44:19: warning: comparison of integer expressions of different signedness: 'long long int' and 'std::__cxx11::basic_string<char>::size_type' {aka 'long unsigned int'} [-Wsign-compare]
44 | for(int j=1; j<s[i].size(); j++) {
| ~^~~~~~~~~~~~
selling_rna.cpp:85:24: warning: comparison of integer expressions of different signedness: 'std::__cxx11::basic_string<char>::size_type' {aka 'long unsigned int'} and 'long long int' [-Wsign-compare]
85 | if(s[i].size() < Q) continue;
| ~~~~~~~~~~~~^~~
selling_rna.cpp:86:53: warning: comparison of integer expressions of different signedness: 'long long int' and 'std::vector<long long int>::size_type' {aka 'long unsigned int'} [-Wsign-compare]
86 | int lhs = (hash[i][hash[i].size() - 1] - (Q == hash[i].size() ? 0 : hash[i][hash[i].size() - Q - 1] * pows[Q]) + MOD * pows[Q]) % MOD;
| ~~^~~~~~~~~~~~~~~~~
# |
Verdict |
Execution time |
Memory |
Grader output |
1 |
Correct |
1 ms |
468 KB |
Output is correct |
2 |
Correct |
1 ms |
484 KB |
Output is correct |
3 |
Correct |
1 ms |
468 KB |
Output is correct |
4 |
Correct |
1 ms |
468 KB |
Output is correct |
5 |
Correct |
1 ms |
476 KB |
Output is correct |
6 |
Correct |
1 ms |
484 KB |
Output is correct |
7 |
Correct |
1 ms |
468 KB |
Output is correct |
# |
Verdict |
Execution time |
Memory |
Grader output |
1 |
Correct |
59 ms |
22300 KB |
Output is correct |
2 |
Correct |
192 ms |
22728 KB |
Output is correct |
3 |
Correct |
72 ms |
22348 KB |
Output is correct |
4 |
Correct |
87 ms |
22500 KB |
Output is correct |
5 |
Correct |
39 ms |
14280 KB |
Output is correct |
6 |
Correct |
43 ms |
14452 KB |
Output is correct |
7 |
Correct |
166 ms |
19404 KB |
Output is correct |
8 |
Correct |
61 ms |
24540 KB |
Output is correct |
9 |
Correct |
74 ms |
24324 KB |
Output is correct |
10 |
Correct |
380 ms |
21864 KB |
Output is correct |
# |
Verdict |
Execution time |
Memory |
Grader output |
1 |
Execution timed out |
1580 ms |
5364 KB |
Time limit exceeded |
2 |
Halted |
0 ms |
0 KB |
- |
# |
Verdict |
Execution time |
Memory |
Grader output |
1 |
Correct |
1 ms |
468 KB |
Output is correct |
2 |
Correct |
1 ms |
484 KB |
Output is correct |
3 |
Correct |
1 ms |
468 KB |
Output is correct |
4 |
Correct |
1 ms |
468 KB |
Output is correct |
5 |
Correct |
1 ms |
476 KB |
Output is correct |
6 |
Correct |
1 ms |
484 KB |
Output is correct |
7 |
Correct |
1 ms |
468 KB |
Output is correct |
8 |
Correct |
59 ms |
22300 KB |
Output is correct |
9 |
Correct |
192 ms |
22728 KB |
Output is correct |
10 |
Correct |
72 ms |
22348 KB |
Output is correct |
11 |
Correct |
87 ms |
22500 KB |
Output is correct |
12 |
Correct |
39 ms |
14280 KB |
Output is correct |
13 |
Correct |
43 ms |
14452 KB |
Output is correct |
14 |
Correct |
166 ms |
19404 KB |
Output is correct |
15 |
Correct |
61 ms |
24540 KB |
Output is correct |
16 |
Correct |
74 ms |
24324 KB |
Output is correct |
17 |
Correct |
380 ms |
21864 KB |
Output is correct |
18 |
Execution timed out |
1580 ms |
5364 KB |
Time limit exceeded |
19 |
Halted |
0 ms |
0 KB |
- |