Submission #528841

#TimeUsernameProblemLanguageResultExecution timeMemory
528841Koosha_mvSelling RNA Strands (JOI16_selling_rna)C++14
100 / 100
300 ms431272 KiB
#include <bits/stdc++.h> using namespace std; #define dbgv(v) cout<<#v<<" = "; f(i,0,v.size()) cout<<v[i]<<" "; cout<<endl #define dbga(a,x,y) cout<<#a<<" = "; f(i,x,y) cout<<a[i]<<" "; cout<<endl #define erorp(x) cout<<#x<<"={"<<(x.F)<<" , "<<x.S<<"}"<<endl #define eror(x) cout<<#x<<'='<<(x)<<endl #define f_(i,a,b) for(int i=a;i>=b;i--) #define f(i,a,b) for(int i=a;i<b;i++) #define nb(x) __builtin_popcount(x) #define all(v) v.begin(),v.end() #define bit(n,k) (((n)>>(k))&1) #define Add(x,y) x=(x+y)%mod #define maxm(a,b) a=max(a,b) #define minm(a,b) a=min(a,b) #define lst(x) x[x.size()-1] #define sz(x) int(x.size()) #define mp make_pair #define ll long long #define pb push_back #define S second #define F first const int N=2e6+99,S=4; int n,m,ans[N],L[N],R[N],fenwik[N]; string s[N],t[N],a[N],b[N]; vector<int> vec[N]; vector<pair<int,int>> Q[N]; void add(int x, int val=1){ for(x++;x<N;x+=x&-x) fenwik[x]+=val; } int get(int x) { int res=0; for (x++;x>0;x-=x&-x) res+=fenwik[x]; return res; } int g(char c){ if(c=='A') return 0; if(c=='U') return 1; if(c=='G') return 2; if(c=='C') return 3; } struct trie{ int cnt,Time,st[N],ft[N],child[N][S]; trie(){ Time=cnt=1; f(i,0,N) f(j,0,S) child[i][j]=0; } void add(string s){ int now=1; f(i,0,s.size()){ int nxt=g(s[i]); if(!child[now][nxt]) child[now][nxt]=++cnt; now=child[now][nxt]; //eror(now); } } void dfs(int u=1){ st[u]=Time++; f(i,0,S) if(child[u][i]) dfs(child[u][i]); ft[u]=Time; } pair<int,int> find(string s){ int now=1; f(i,0,s.size()){ int nxt=g(s[i]); if(!child[now][nxt]) return {st[now],ft[now]}; now=child[now][nxt]; } return {st[now],ft[now]}; } } t1,t2; int main(){ ios::sync_with_stdio(false);cin.tie(nullptr);cout.tie(nullptr); cin>>n>>m; f(i,0,n) cin>>s[i],t[i]=s[i],reverse(all(t[i])); f(i,0,m){ cin>>a[i]>>b[i]; reverse(all(b[i])); t1.add(a[i]); t2.add(b[i]); } t1.dfs(); t2.dfs(); f(i,0,n){ vec[t1.find(s[i]).F].pb(t2.find(t[i]).F); //cout<<t1.find(s[i]).F<<" - "<<t2.find(t[i]).F<<endl; } f(i,0,m){ pair<int,int> e1=t1.find(a[i]),e2=t2.find(b[i]); e1.F--,e1.S--; e2.F--,e2.S--; //erorp(e1); //erorp(e2); L[i]=e2.F; R[i]=e2.S; Q[e1.F].pb({i,-1}); Q[e1.S].pb({i,+1}); } f(i,0,N){ for(auto x : vec[i]) add(x); for(auto p : Q[i]){ int res=get(R[p.F])-get(L[p.F]); ans[p.F]+=res*p.S; } } f(i,0,m) cout<<ans[i]<<" "; } /* 2 1 GCGCUACCCCAACACAAGGCAAGAUAUA GCGCUACCCCAACACAAGGCAAGAUGGUC GCGCUACCC A GCGCUACCCC AC GCG C GCGC A G G G C G GGA */

Compilation message (stderr)

selling_rna.cpp: In member function 'void trie::add(std::string)':
selling_rna.cpp:8:31: warning: comparison of integer expressions of different signedness: 'int' and 'std::__cxx11::basic_string<char>::size_type' {aka 'long unsigned int'} [-Wsign-compare]
    8 | #define f(i,a,b) for(int i=a;i<b;i++)
......
   47 |   f(i,0,s.size()){
      |     ~~~~~~~~~~~~               
selling_rna.cpp:47:3: note: in expansion of macro 'f'
   47 |   f(i,0,s.size()){
      |   ^
selling_rna.cpp: In member function 'std::pair<int, int> trie::find(std::string)':
selling_rna.cpp:8:31: warning: comparison of integer expressions of different signedness: 'int' and 'std::__cxx11::basic_string<char>::size_type' {aka 'long unsigned int'} [-Wsign-compare]
    8 | #define f(i,a,b) for(int i=a;i<b;i++)
......
   61 |   f(i,0,s.size()){
      |     ~~~~~~~~~~~~               
selling_rna.cpp:61:3: note: in expansion of macro 'f'
   61 |   f(i,0,s.size()){
      |   ^
selling_rna.cpp: In function 'int g(char)':
selling_rna.cpp:38:1: warning: control reaches end of non-void function [-Wreturn-type]
   38 | }
      | ^
#Verdict Execution timeMemoryGrader output
Fetching results...
#Verdict Execution timeMemoryGrader output
Fetching results...
#Verdict Execution timeMemoryGrader output
Fetching results...
#Verdict Execution timeMemoryGrader output
Fetching results...